View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2900_low_22 (Length: 237)

Name: NF2900_low_22
Description: NF2900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2900_low_22
NF2900_low_22
[»] chr3 (1 HSPs)
chr3 (1-178)||(26670702-26670877)


Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 26670702 - 26670877
Alignment:
1 gcaaaggaagcaggggtggagcgtgtggtggcgacgtcgtcgatctccgccatcataccgagtcctagctggccagctgataagattaaggcagaggatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26670702 gcaaaggaagcaggggtggagcgtgtggtggcgacgtcgtcgatctccgccatcataccgagtcctagctggccagctgataagattaaggcagaggatt 26670801  T
101 gttggacggaccttgactattgcaaggaaaagaaggtgagttttttctagtttaactttcagttataattgatgtttt 178  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||    
26670802 gttggacggaccttgaatattgcaaggaaaagaaggtgagttttttctagtttaac--tcagttataattgatgtttt 26670877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University