View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2901_high_5 (Length: 257)

Name: NF2901_high_5
Description: NF2901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2901_high_5
NF2901_high_5
[»] chr8 (1 HSPs)
chr8 (22-162)||(11612380-11612520)


Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 22 - 162
Target Start/End: Original strand, 11612380 - 11612520
Alignment:
22 tcatatgttagtactctcttctcttttttcatgtgtccctattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat 121  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11612380 tcatatgttagtactctcttctcttttttcatgtgtcactattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat 11612479  T
122 atcttttactgcttttcacttaattcaccaaagttcttacc 162  Q
    |||||||||||||||||||||||||||||||||||||||||    
11612480 atcttttactgcttttcacttaattcaccaaagttcttacc 11612520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University