View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2901_low_4 (Length: 340)
Name: NF2901_low_4
Description: NF2901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2901_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 85 - 322
Target Start/End: Complemental strand, 7059459 - 7059222
Alignment:
| Q |
85 |
gatctgatatcaatgcagctgaaaacgacccttcactagttgcaatcaatagacagcaagacttctcagaaaaccaagcaatgcaatccacaaccaccat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059459 |
gatctgatatcaatgcagctgaaaacgacccttcactagttgcaatcaatagacagcaagacttctcagaaaaccaagcaatgcaatccacaaccaccat |
7059360 |
T |
|
| Q |
185 |
aaacaccaccgtctctgaggtggtggttccaccctttgattcagacctgccaccacacagatcaatggccatggatgacacgtgtcgatatggaagctta |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059359 |
aaacaccaccgtctctgaggtggtggttccaccctttgattcagacctgccaccacacagatcaatggccatggatgacacgtgtcgatatggaagctta |
7059260 |
T |
|
| Q |
285 |
gttgcagaagattatgaaacaggttctgacattggatc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7059259 |
gttgcagaagattatgaaacaggttctgacattggatc |
7059222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University