View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2901_low_7 (Length: 261)
Name: NF2901_low_7
Description: NF2901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2901_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 25 - 184
Target Start/End: Complemental strand, 35284522 - 35284363
Alignment:
| Q |
25 |
gaacccaaaacattcccctcaagatatgtgagtacaatgctgtgagattctttcattttcttgtgctgttttcttttactttctttcttaaacggcctct |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35284522 |
gaacccaaaacattcccctcaagatatgtgagtacaatgctgtgagattctttcattttcttgcgctgttttcttttactttctttcttaaacggcctct |
35284423 |
T |
 |
| Q |
125 |
tatccgtattctatgacatgcatgtatatctctataggcaacagatgcaaggatcctccg |
184 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35284422 |
tatccgtattctatggcatgcatgtatatctctataggcaacagatgcaaggatcctccg |
35284363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 181 - 244
Target Start/End: Complemental strand, 35242124 - 35242057
Alignment:
| Q |
181 |
tccggtcagagtcaggttatatatgatg----aatgttcaatgttagttcatggttcttggtttcata |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| | |||||||| |||||||| |
|
|
| T |
35242124 |
tccggtcagagtcaggttatatatgatggctaaatgttcaatgttaataactggttcttagtttcata |
35242057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 244
Target Start/End: Complemental strand, 35272262 - 35272199
Alignment:
| Q |
185 |
gtcagagtcaggttatatatgatg----aatgttcaatgttagttcatggttcttggtttcata |
244 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||| |
|
|
| T |
35272262 |
gtcagagtcaggttatatatgatggctaaatgttcaatgttaataactggttcttggtttcata |
35272199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University