View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2901_low_8 (Length: 257)
Name: NF2901_low_8
Description: NF2901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2901_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 22 - 162
Target Start/End: Original strand, 11612380 - 11612520
Alignment:
| Q |
22 |
tcatatgttagtactctcttctcttttttcatgtgtccctattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612380 |
tcatatgttagtactctcttctcttttttcatgtgtcactattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
11612479 |
T |
 |
| Q |
122 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612480 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
11612520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University