View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2902_high_7 (Length: 315)
Name: NF2902_high_7
Description: NF2902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2902_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 19190113 - 19190286
Alignment:
| Q |
1 |
tccggtgttcctaccggacgaaaaaatggttattctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190113 |
tccggtgttcctaccggacgaaaaaagggttattctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagagtg |
19190212 |
T |
 |
| Q |
101 |
gttatggacgttatggtggtggtactacaggtggtggttacggtcttgataaccgatctaacagtggttatgga |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190213 |
gttatggacgttatggtggtggtactacaggtggtggttacggtcttgataaccgatctaacagtggttatgga |
19190286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 239 - 315
Target Start/End: Original strand, 19190351 - 19190427
Alignment:
| Q |
239 |
atgggaataataacgagagcgggtatggaggtggacgttttggtggtggttatggttccgatgaccgttctggtggt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190351 |
atgggaataataacgagagcgggtatggaggtggacgttttggtggtggttatggttccgatgaccgttctggtggt |
19190427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University