View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2902_low_14 (Length: 275)
Name: NF2902_low_14
Description: NF2902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2902_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 18 - 166
Target Start/End: Original strand, 32325324 - 32325473
Alignment:
| Q |
18 |
aagacaatggatgttgaaggcatcaactctaccgatatcgatgaagttttacgtggagataatagttctgtggaagactcaagtggaagcaagatagggt |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325324 |
aagacaatggatgttgatggcatcaactctaccgataccgatgaagttttacgtggagataatagttctgtggaagactcaagtggaagcaagatagggt |
32325423 |
T |
|
| Q |
118 |
actcatctgaaaatgtattagtt-gaaaggaagctcagtaagaacaatgg |
166 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32325424 |
actcatctgaaaatgtattagttggaaaggaagctcagtaagaacaatgg |
32325473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University