View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2903R-Insertion-5 (Length: 166)
Name: NF2903R-Insertion-5
Description: NF2903R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2903R-Insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 8 - 140
Target Start/End: Original strand, 52582217 - 52582349
Alignment:
| Q |
8 |
agggagtatagtgatcaacaaaagggagtatcgtgaacaaaaaataatataacgaaaattaatttcatgaattaactaaaagtagaaaaagtacacagta |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52582217 |
agggagtatagtgaacaacaaaagggagtatcgtgaacaacaaataatataacgaaaattaatttcatgcattaactaaaagtagaaaaagtacacagta |
52582316 |
T |
|
| Q |
108 |
atcattagttctccttacaaattcacaggttct |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52582317 |
atcattagttctccttacaaattcacaggttct |
52582349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University