View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2904_low_7 (Length: 360)
Name: NF2904_low_7
Description: NF2904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2904_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 13866095 - 13866436
Alignment:
| Q |
1 |
atagtagttctagctaggaaaaatgagagatgaacatgattattatgaaattgatggtggaatttttagaagggaaatatatgaacggtttagttcttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13866095 |
atagtagttctagctaggaaaaatgagagatgaacatgattattatgaaattgatggtggaatttttagaagggaaatatatgaacggtttagttcttga |
13866194 |
T |
|
| Q |
101 |
tggtgatgaaagcatgattaaaatatttgagggggtagggtatatgggaaattgtttaaatgttttatttttatatagaatgtgatttaattaagtgtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13866195 |
tggtgatgaaagcatgattaaaatatttgagggggtagggtatatgggaaattgtttaaatgttttatttttatatagaatgtgatttaattaagtgtgg |
13866294 |
T |
|
| Q |
201 |
tttatggaagacttagactttgtcattttagtctaatcttccctacacgtttataccttcctcacgtttcatctgatttattttcaacatggatgttttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13866295 |
tttatggaagacttagactttgtcattttagtctaatcttccctacacgtttacaccttcctcacgtttcatctgatttattttcagcatggatgttttt |
13866394 |
T |
|
| Q |
301 |
cctaggtactattctttggtgatgtctataaggtaccattct |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13866395 |
cctaggtactattctttggtgatgtctataaggtaccattct |
13866436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University