View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2904_low_8 (Length: 355)
Name: NF2904_low_8
Description: NF2904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2904_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 19 - 336
Target Start/End: Complemental strand, 53639299 - 53638987
Alignment:
| Q |
19 |
gaagcagcgagaggaagtgcatgcgatgcgattcaaggatcaaggttaggtttcggaaaatagaagaatcgaatggaagagggaaggacgaaacgatgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53639299 |
gaagcagcgagaggaagtgcatgcgatgcgattcaaggattaaggttaggtttcggaaaatagaagaatcgaatggaagagggaaggacgaaacgatgat |
53639200 |
T |
|
| Q |
119 |
gagaatcaggatttggatttggatttggattcactcaccctcttctcctccacctttcagttatgggatctat-gttacttgttttcgaaaattcctttt |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53639199 |
gagaatcaggatttggatttggatt------cactcaccctcttctcctccacctttcagttatgggatctattgttacttgttttcgaaaattcctttt |
53639106 |
T |
|
| Q |
218 |
agactacagtatttgctaaactgacaaaaataccctcgaccacaagaaactcatgtttgcttgtctattgtacttgattgtcattgtcccaacgatagtt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53639105 |
agactacagtatttgctaaactgacaaaaataccctcgaccgctagaaactcatgtttgcttgtctattgtacttgattgtcattgtcccaacgatagtt |
53639006 |
T |
|
| Q |
318 |
aacgttgaaatacgtattt |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53639005 |
aacgttgaaatacgtattt |
53638987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University