View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2906_high_15 (Length: 339)
Name: NF2906_high_15
Description: NF2906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2906_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 154 - 325
Target Start/End: Original strand, 2592554 - 2592726
Alignment:
| Q |
154 |
ggcgattgaaacctgtagaaggaaaggttatttgattttgaagatacttgcatacaaaagatgtattggatcatttggtatttgactgtacaaagtggtg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2592554 |
ggcgattgaaacctgtagaaggaaaggttatttgattttgaagatacttgcatacaaaagatgtattggatcatttggtatttgactgtacaaagtgctg |
2592653 |
T |
 |
| Q |
254 |
gttttttcttgaatgat-aataatgggtttaccttttcaacatttgtgtctcttttatacaagaaccacaggt |
325 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2592654 |
gttttttcttgaatgataaataatgggtttgccttttcaacatttgtgtctcttttatacaacaaccacaggt |
2592726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 31 - 127
Target Start/End: Original strand, 2592431 - 2592527
Alignment:
| Q |
31 |
gattgctgattggaaagatttgagtgaaaatatactgtatatgtatatgtataacgaggcttgaagtgttttgttgagtgttttgacatggaagagg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2592431 |
gattgctgattggaaagatttgagtgaaaatataatgtatatgtatatgtataacgaggcttgaagtgttttgttgagtgttttgacatggaagagg |
2592527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University