View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2906_high_19 (Length: 294)
Name: NF2906_high_19
Description: NF2906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2906_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 20 - 154
Target Start/End: Complemental strand, 42358382 - 42358239
Alignment:
| Q |
20 |
ttcggcggtggatttggatccaaaaccgcttggacccgccgatccgattaggtatttaatcgtttcaagcatcttgtgaaattaa---------aagcaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42358382 |
ttcggcggtggatttggatccaaaaccgcttggacccgccgatccgattaggtatttaatcgtttcaagcatcttgtgaaattaaatctgaagcaagcaa |
42358283 |
T |
|
| Q |
111 |
tagtggttctggtttgggtttattttgtgaatccaccgtgaaat |
154 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42358282 |
tagtggttctggtttgggtttatttggtgaatccaccgtgaaat |
42358239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 282
Target Start/End: Complemental strand, 42358234 - 42358170
Alignment:
| Q |
213 |
aggtggttggttatcttttacatacactgtcagtatgctatgcttagattagatgctatatatacaattc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42358234 |
aggtggttggttatcttttacatacactgtcagtatgctatgctt-----agatgctatatatacaattc |
42358170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University