View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2907_high_1 (Length: 643)
Name: NF2907_high_1
Description: NF2907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2907_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 7e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 448 - 508
Target Start/End: Original strand, 8105049 - 8105109
Alignment:
| Q |
448 |
taagtgatgatggagtagaatattggttgttaaagaattcatggggtgaagccggctatta |
508 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8105049 |
taagtgatgatggagtagaatattggttgttaaagaattcatggggtgaagccggctatta |
8105109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 549 - 623
Target Start/End: Original strand, 8105113 - 8105191
Alignment:
| Q |
549 |
tatagaccacttttttggtat----aggagcccctttcttctctttgatgcttttgaaggataattgtaaaaagaatat |
623 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8105113 |
tatagaccacttttttggtatgtataggatcccctttcttctctttgatgcttttgaaggataattgtaaaaagaatat |
8105191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University