View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2909_high_12 (Length: 253)
Name: NF2909_high_12
Description: NF2909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2909_high_12 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 37968746 - 37968981
Alignment:
| Q |
18 |
ctttcgatttggtttttaggttgaggaagcactaagcagttgttatgactatgataataaatatttttagaaaagtatgaaaagaatgatggatcttgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968746 |
ctttcgatttggtttttaggttgaggaagcactaagcagttgttatgactatgataataaatatttttagaaaagtatgaaaagaatgatggatcttgta |
37968845 |
T |
|
| Q |
118 |
aatcttattgttttattctgtattgcaggggaagaagaatcccggaacagatgaacaatctgttttgtcatttctaaatcaagtaatgaaagctaaggaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968846 |
aatcttattgttttattctgtattgcaggggaagaagaatcccggaacagatgaacaatctgttttgtcatttctaaatcaagtaatgaaagctaaggaa |
37968945 |
T |
|
| Q |
218 |
atgaaaattgacaagtaatgaaatttcctccttttt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37968946 |
atgaaaattgacaagtaatgaaatttcctccttttt |
37968981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 135 - 238
Target Start/End: Original strand, 15971144 - 15971247
Alignment:
| Q |
135 |
ctgtattgcaggggaagaagaatcccggaacagatgaacaatctgttttgtcatttctaaatcaagtaatgaaagctaaggaaatgaaaattgacaagta |
234 |
Q |
| |
|
||||||| |||||||||||||| || ||||||||| ||| || ||| | | ||| |||||||||| |||| || |||||||||||||| |||||||| |
|
|
| T |
15971144 |
ctgtatttcaggggaagaagaacccaggaacagatcaacgctcagttgaggcgtttttaaatcaagtcatgagggcaaaggaaatgaaaatagacaagta |
15971243 |
T |
|
| Q |
235 |
atga |
238 |
Q |
| |
|
|||| |
|
|
| T |
15971244 |
atga |
15971247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University