View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2909_high_21 (Length: 226)
Name: NF2909_high_21
Description: NF2909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2909_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 96 - 213
Target Start/End: Original strand, 41936195 - 41936312
Alignment:
| Q |
96 |
ttttacaataaaatacgatttcaattttcataatttttagtgcttaaatcagtcattacatgttctttagctttgacgtaggctcttagacttgtaggat |
195 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
41936195 |
ttttacgataaaatatgatttcaatttctataatttttactgcttaactcagtcattacatgttctttagctttgttgtaggctcttagacttgtaatat |
41936294 |
T |
|
| Q |
196 |
gaagatatcaggtgcttc |
213 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
41936295 |
gaagaaatcaggtgcttc |
41936312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4304553 - 4304505
Alignment:
| Q |
1 |
ggatatcttcaattgcaaacctcgctgctgaaaaaattattatggagga |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4304553 |
ggatatcttcaattgcaaacctcggtgctgaaaaaattattatggagga |
4304505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 191 - 226
Target Start/End: Complemental strand, 4304508 - 4304473
Alignment:
| Q |
191 |
aggatgaagatatcaggtgcttcatacaagcctagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4304508 |
aggatgaagatatcaggtgcttcatacaagcctagt |
4304473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University