View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2909_low_12 (Length: 255)
Name: NF2909_low_12
Description: NF2909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2909_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 43093883 - 43093810
Alignment:
| Q |
168 |
gaacaacaaagaacaagatgggtgatggagaaaaatttcaattgggaactatcggtgcactgagtctatctgtg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43093883 |
gaacaacaaagaacaagatgggtgatggagaaaaatttcaattgggaactatcggtgcactgagtctatctgtg |
43093810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 43094049 - 43093947
Alignment:
| Q |
1 |
aaaacacccaattagtttcactttctttttcttgtgtgagtttattttgttctcaatgannnnnnnnnnaaattgttattttggttaatcctgcatccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43094049 |
aaaacacccaattagtttcactttctttttcttgtgtgagtttgttctgttctcaatga-tttttttttaaattgttattttggttaatcctgcatccat |
43093951 |
T |
 |
| Q |
101 |
tcac |
104 |
Q |
| |
|
|||| |
|
|
| T |
43093950 |
tcac |
43093947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University