View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2909_low_12 (Length: 255)

Name: NF2909_low_12
Description: NF2909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2909_low_12
NF2909_low_12
[»] chr3 (2 HSPs)
chr3 (168-241)||(43093810-43093883)
chr3 (1-104)||(43093947-43094049)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 43093883 - 43093810
Alignment:
168 gaacaacaaagaacaagatgggtgatggagaaaaatttcaattgggaactatcggtgcactgagtctatctgtg 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43093883 gaacaacaaagaacaagatgggtgatggagaaaaatttcaattgggaactatcggtgcactgagtctatctgtg 43093810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 43094049 - 43093947
Alignment:
1 aaaacacccaattagtttcactttctttttcttgtgtgagtttattttgttctcaatgannnnnnnnnnaaattgttattttggttaatcctgcatccat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||          |||||||||||||||||||||||||||||||    
43094049 aaaacacccaattagtttcactttctttttcttgtgtgagtttgttctgttctcaatga-tttttttttaaattgttattttggttaatcctgcatccat 43093951  T
101 tcac 104  Q
    ||||    
43093950 tcac 43093947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University