View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2909_low_14 (Length: 253)
Name: NF2909_low_14
Description: NF2909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2909_low_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 53000975 - 53000716
Alignment:
| Q |
11 |
cagagaagggctaatagtaagtaataaggttgttgtatgtttttactaccacggttaattaattagctagaagaaataaatta--ctggtcagtggtcac |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
53000975 |
cagagaagggctaatagtaa----taaggttgttgtatgtttttactaccacggttaattaattagctagaagaaataaattatactggtcagtggtcac |
53000880 |
T |
 |
| Q |
109 |
tttctttgttccgtggt-------------------ttggtagggtcacatattcacttgaatatatacctcatttttgttagatagtttcactgttgtt |
189 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53000879 |
tttctttgttccgtggtggagggtgtggtaactggtttggtagggtcacatattcacttgaatatatacctcatttttgttagatagtttcactgttgtt |
53000780 |
T |
 |
| Q |
190 |
accagatactaacaaatctcgttcacagaacatgggtagtctcttttaaagactgtgataaacc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53000779 |
accagatactaacaaatctcgttcacagaacatgggtagtctcttttaaagactgtgataaacc |
53000716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University