View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2909_low_26 (Length: 226)

Name: NF2909_low_26
Description: NF2909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2909_low_26
NF2909_low_26
[»] chr5 (1 HSPs)
chr5 (96-213)||(41936195-41936312)
[»] chr2 (2 HSPs)
chr2 (1-49)||(4304505-4304553)
chr2 (191-226)||(4304473-4304508)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 96 - 213
Target Start/End: Original strand, 41936195 - 41936312
Alignment:
96 ttttacaataaaatacgatttcaattttcataatttttagtgcttaaatcagtcattacatgttctttagctttgacgtaggctcttagacttgtaggat 195  Q
    |||||| |||||||| |||||||||||  |||||||||| ||||||| |||||||||||||||||||||||||||  |||||||||||||||||||  ||    
41936195 ttttacgataaaatatgatttcaatttctataatttttactgcttaactcagtcattacatgttctttagctttgttgtaggctcttagacttgtaatat 41936294  T
196 gaagatatcaggtgcttc 213  Q
    ||||| ||||||||||||    
41936295 gaagaaatcaggtgcttc 41936312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4304553 - 4304505
Alignment:
1 ggatatcttcaattgcaaacctcgctgctgaaaaaattattatggagga 49  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||    
4304553 ggatatcttcaattgcaaacctcggtgctgaaaaaattattatggagga 4304505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 191 - 226
Target Start/End: Complemental strand, 4304508 - 4304473
Alignment:
191 aggatgaagatatcaggtgcttcatacaagcctagt 226  Q
    ||||||||||||||||||||||||||||||||||||    
4304508 aggatgaagatatcaggtgcttcatacaagcctagt 4304473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University