View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2910_high_16 (Length: 236)
Name: NF2910_high_16
Description: NF2910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2910_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 396668 - 396895
Alignment:
| Q |
1 |
ccaactccagagaggctttctttagttacttttactttgcactcaatgttggatcactcttttccaacaccattttggtttattacgaagataccggtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
396668 |
ccaactccagagaggctttctttagttacttttactttgcactcaatgttggatcactattttccaacaccattttggtttattacgaagataccggtat |
396767 |
T |
 |
| Q |
101 |
gtggacattgggtttcggtgtctccttggcctctgctattatagccttgatttcattcttagcaggatctcgaaaatatcgatatgttaaggcgtatggc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
396768 |
gtggacattgggtttcggtgtctccttagcctctgctattatagccttgatttcattcttagcaggatctcgaaaatatcgatatgttaaggcgtatggc |
396867 |
T |
 |
| Q |
201 |
aatcctgtcataagagtaatccaggtct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
396868 |
aatcctgtcataagagtaatccaggtct |
396895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 3803972 - 3803753
Alignment:
| Q |
9 |
agagaggctttctttagttacttttactttgcactcaatgttggatcactcttttccaacaccattttggtttattacgaagataccggtatgtggacat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
3803972 |
agagaggctttctttagttacttttactttgcactcaatgttggatcactcttttccaacaccattttggtttattatgaagattccggtatgtggacat |
3803873 |
T |
 |
| Q |
109 |
tgggtttcggtgtctccttggcctctgctattatagccttgatttcattcttagcaggatctcgaaaatatcgatatgttaaggcgtatggcaatcctgt |
208 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| |||||||| |
|
|
| T |
3803872 |
tgggtttcggtgtctcgctagcctctgctattatagccttgatttcattcttagcaggatctcgaagatatcgttatgttaaggcgtgtgggaatcctgt |
3803773 |
T |
 |
| Q |
209 |
cataagagtaatccaggtct |
228 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
3803772 |
cataagagtaattcaggtct |
3803753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University