View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2910_low_10 (Length: 290)
Name: NF2910_low_10
Description: NF2910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2910_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 6 - 275
Target Start/End: Original strand, 41160037 - 41160306
Alignment:
| Q |
6 |
aggagcagagacagcttcaataaaggaatcaacaggagatgacacgtgtgatggactattagattctgtaatacttgactttgctttggtagattgaaac |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41160037 |
aggagaagagacagcttcaataaaggaatcaacaggagatgacacgtgtgatggactattagattctgtaatacttgactttgctttggtagattgaaac |
41160136 |
T |
 |
| Q |
106 |
attacaacnnnnnnnnnnnnnnnnnnnnnnnngacttcataaaacatgtttgagttagaagaggccaatttcttcaccagaatctgaagttgttctctag |
205 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41160137 |
attacaacgttgttgttgttgttgttttgttggacttcataaaacatgtttgagttagaagaggccaatttcttcaccagaatttgaagttgttctctag |
41160236 |
T |
 |
| Q |
206 |
cttggtctctttctttataagctatttcaagcatgttgagcaattcatccttcacattccttgtgttttc |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41160237 |
cttggtctctttctttataagctatttcaagcatgttgagcaattcatccttcacattccttgtgttttc |
41160306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University