View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2910_low_12 (Length: 278)
Name: NF2910_low_12
Description: NF2910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2910_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 156 - 261
Target Start/End: Complemental strand, 47349667 - 47349559
Alignment:
| Q |
156 |
ctcatttatgctctcaactttttctctcgcgtcgttcctcttccctctaacctt---gatttcgtttcttccatctattgtctcaacaacaatgtcaatg |
252 |
Q |
| |
|
||||||| ||||||||| ||| ||||||||| |||||||||||||||| ||||| |||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47349667 |
ctcatttctgctctcaattttctctctcgcgacgttcctcttccctctcaccttctcgattccgtttcttccatctatcgtctcaacaacaatgtcaatg |
47349568 |
T |
 |
| Q |
253 |
taatgctcc |
261 |
Q |
| |
|
||||||||| |
|
|
| T |
47349567 |
taatgctcc |
47349559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University