View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2910_low_12 (Length: 278)

Name: NF2910_low_12
Description: NF2910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2910_low_12
NF2910_low_12
[»] chr1 (1 HSPs)
chr1 (156-261)||(47349559-47349667)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 156 - 261
Target Start/End: Complemental strand, 47349667 - 47349559
Alignment:
156 ctcatttatgctctcaactttttctctcgcgtcgttcctcttccctctaacctt---gatttcgtttcttccatctattgtctcaacaacaatgtcaatg 252  Q
    ||||||| ||||||||| ||| ||||||||| |||||||||||||||| |||||   |||| |||||||||||||||| |||||||||||||||||||||    
47349667 ctcatttctgctctcaattttctctctcgcgacgttcctcttccctctcaccttctcgattccgtttcttccatctatcgtctcaacaacaatgtcaatg 47349568  T
253 taatgctcc 261  Q
    |||||||||    
47349567 taatgctcc 47349559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University