View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2910_low_17 (Length: 247)
Name: NF2910_low_17
Description: NF2910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2910_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 242
Target Start/End: Original strand, 36429634 - 36429843
Alignment:
| Q |
24 |
ttaacaacatgagtaaattacattcacattttgttgatggtaaataagaatttgtctagtatatatgaaaagggaaaagttaatacccacaccacacgaa |
123 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
36429634 |
ttaacaacatgagtaaattacatacacattttgttgatggtaaataagaatttgtctagtat----gaaaagggaaaagttaatacccac-----acgaa |
36429724 |
T |
 |
| Q |
124 |
cgatgttttcattggattctccttattcacgtgccctccttcctctcattgtaggacaccattttggtcatcaactcatcatgtaacgaacccagagcta |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36429725 |
cgatgttttcattggattctccttattcacgtgccctccctcctctcattgtaggacaccattttggtcatcaactcatcatgtaacgaacccagagcta |
36429824 |
T |
 |
| Q |
224 |
acatcattttcatctcact |
242 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
36429825 |
acatcattttcatatcact |
36429843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University