View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2911-1-Insertion-18 (Length: 191)
Name: NF2911-1-Insertion-18
Description: NF2911-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2911-1-Insertion-18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 52922628 - 52922811
Alignment:
| Q |
8 |
atatgatgatatagtgacttgaatgtggtgctcaatgaatccaaacacgctctcaagtctcaatttatactcaaccaaatttaaggttggcaaaatgagg |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52922628 |
atatgatgatataatgacttgaatgtggtgttcaatgaatccaaacacgctctcaggtctcaatctatactcaaccaaatttaaggttggcaaaatgagg |
52922727 |
T |
 |
| Q |
108 |
tcagtatgatccattttagacgtcgaggtgagttgaaattatgaaggggtaaagctaatgttggagaacccatttgctctataa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
52922728 |
tcagtatgatccattttagacgtcgaggtgagttgaaattatgaaggggcaaagctagtgttggagaacccatttgctctataa |
52922811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University