View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2911-2-Insertion-20 (Length: 51)
Name: NF2911-2-Insertion-20
Description: NF2911-2
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2911-2-Insertion-20 |
 |  |
|
| [»] chr3 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 6e-17; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 6072883 - 6072840
Alignment:
| Q |
8 |
cctatatgttcctagatcaaagactatttaaggtttatactcgc |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6072883 |
cctatatgttcctagatcaaagactatttaaggtttatactcgc |
6072840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 12 - 49
Target Start/End: Complemental strand, 6089205 - 6089168
Alignment:
| Q |
12 |
tatgttcctagatcaaagactatttaaggtttatactc |
49 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
6089205 |
tatgttcctggatcaaagactatttaatgtttatactc |
6089168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 12 - 49
Target Start/End: Original strand, 6114238 - 6114275
Alignment:
| Q |
12 |
tatgttcctagatcaaagactatttaaggtttatactc |
49 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
6114238 |
tatgttcctagatcaaaaactatttaatgtttatactc |
6114275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 12 - 49
Target Start/End: Original strand, 6121128 - 6121165
Alignment:
| Q |
12 |
tatgttcctagatcaaagactatttaaggtttatactc |
49 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
6121128 |
tatgttcctagatcaaatactatttaatgtttatactc |
6121165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 27; E-Value: 0.0000008
Query Start/End: Original strand, 13 - 51
Target Start/End: Complemental strand, 6076949 - 6076911
Alignment:
| Q |
13 |
atgttcctagatcaaagactatttaaggtttatactcgc |
51 |
Q |
| |
|
||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
6076949 |
atgttccaagatcaaagagtatttaatgtttatactcgc |
6076911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 28; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000002
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 9939545 - 9939510
Alignment:
| Q |
11 |
atatgttcctagatcaaagactatttaaggtttata |
46 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
9939545 |
atatgttcctagatcaaacactatctaaggtttata |
9939510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University