View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2911-6-Insertion-11 (Length: 890)
Name: NF2911-6-Insertion-11
Description: NF2911-6
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2911-6-Insertion-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 5e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 5e-40
Query Start/End: Original strand, 219 - 307
Target Start/End: Original strand, 48008659 - 48008747
Alignment:
| Q |
219 |
ggctgctaagattcttgccaacatgattgtgattggtgggagcatcttggcaagaggagttgttgcagcgtatcgtcaagcacttcaaa |
307 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48008659 |
ggctgctaagattcttgccaacttgattgtgattggtgggagcatcttggcaagaggagttgttgcagcgtatcgtcaagcacttcaaa |
48008747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 83; Significance: 8e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 8e-39
Query Start/End: Original strand, 788 - 890
Target Start/End: Complemental strand, 3165112 - 3165011
Alignment:
| Q |
788 |
cttgcttttttggggatcttctgccaggatacaagacggctggcaatgacttcatcgattccttcctcagtcgctgcagtcacggattcatctgaccctt |
887 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3165112 |
cttgcttttttggggatcttctgctaggatacaagatggctggcaatgacttcatcga-tccttccttagtcgctgcagtcacggattcatctgaccctt |
3165014 |
T |
|
| Q |
888 |
tca |
890 |
Q |
| |
|
||| |
|
|
| T |
3165013 |
tca |
3165011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University