View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2911-8-Insertion-18 (Length: 126)
Name: NF2911-8-Insertion-18
Description: NF2911-8
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2911-8-Insertion-18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 4731054 - 4730936
Alignment:
| Q |
8 |
acatcttcatttagagtttttattttctttcacggctattttcggtttgaatttatctctccccattttgattcagcagccatccataagaaaactgctg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4731054 |
acatcttcatttagagtttttattttctttcacggatattttcggtttgaatttatctctccccattttgattcagcagccatccataaaaaaactgctg |
4730955 |
T |
 |
| Q |
108 |
atatcacttcaataattag |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4730954 |
atatcacttcaataattag |
4730936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University