View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2911-Insertion-18 (Length: 898)
Name: NF2911-Insertion-18
Description: NF2911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2911-Insertion-18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 2e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 2e-42
Query Start/End: Original strand, 220 - 308
Target Start/End: Original strand, 48008659 - 48008747
Alignment:
| Q |
220 |
ggctgctaagattcttgccaacttgattgtgattggtgggagcatcttggcaagaggagttgttgcagcgtatcgtcaagcacttcaaa |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48008659 |
ggctgctaagattcttgccaacttgattgtgattggtgggagcatcttggcaagaggagttgttgcagcgtatcgtcaagcacttcaaa |
48008747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 4e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 4e-31
Query Start/End: Original strand, 790 - 898
Target Start/End: Complemental strand, 3165112 - 3165007
Alignment:
| Q |
790 |
cttgcttttttggggatcttctgccaggatacaagacggctgggcaatgacttcatcgatttctttcctcagtcgctgcagtcaccgattcatctgaccc |
889 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||| | ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
3165112 |
cttgcttttttggggatcttctgctaggatacaagatggctgg-caatgacttcatcgat--ccttccttagtcgctgcagtcacggattcatctgaccc |
3165016 |
T |
|
| Q |
890 |
tttcattca |
898 |
Q |
| |
|
||||||||| |
|
|
| T |
3165015 |
tttcattca |
3165007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 218 - 282
Target Start/End: Complemental strand, 13428335 - 13428271
Alignment:
| Q |
218 |
caggctgctaagattcttgccaacttgattgtgattggtgggagcatcttggcaagaggagttgt |
282 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||| |||||| | ||||| ||||||| |||||| |
|
|
| T |
13428335 |
caggctgcaaagattctcgcaaacttgattgtgatgggtgggggaatcttagcaagagcagttgt |
13428271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University