View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2911-Insertion-41 (Length: 158)
Name: NF2911-Insertion-41
Description: NF2911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2911-Insertion-41 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 2e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 68 - 158
Target Start/End: Original strand, 34854974 - 34855064
Alignment:
| Q |
68 |
tctctagtatagcaataaagttagatatgagggatggttacaagctcattgaaaaacaagaacacttcttctatccactctaacttaacaa |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34854974 |
tctctagtatagcaataaagttagatatgagggatggttacaagctcattgaaaaacaagaacacttcttctatccactctaacttaacaa |
34855064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 46
Target Start/End: Original strand, 34854939 - 34854977
Alignment:
| Q |
8 |
gtttagaattttgagtttatttggctttgttttcttctc |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34854939 |
gtttagaattttgagtttatttggctttgttttcttctc |
34854977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University