View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2911-Insertion-44 (Length: 115)
Name: NF2911-Insertion-44
Description: NF2911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2911-Insertion-44 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 12 - 115
Target Start/End: Complemental strand, 47736617 - 47736514
Alignment:
| Q |
12 |
catcatctgaaatatgagacagaactggttatgaaggtcatcatcgtaactacaataaaagagtgacaaaaaagattagcacgccagatgcttaccattg |
111 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47736617 |
catcatctgaaatatgagacataactggttatgaaggtcatcatcgtaactacaataaaagagtgacaaaaaaggttagcacgccagatgcttaccattg |
47736518 |
T |
|
| Q |
112 |
ctta |
115 |
Q |
| |
|
|||| |
|
|
| T |
47736517 |
ctta |
47736514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University