View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2912_high_19 (Length: 243)

Name: NF2912_high_19
Description: NF2912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2912_high_19
NF2912_high_19
[»] chr5 (1 HSPs)
chr5 (15-224)||(33162100-33162309)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 33162309 - 33162100
Alignment:
15 cagagactagaagggaaggggataggcagtgggaaatttggtggtgccgccggacggcaacggcggcgagggagaggctcgcagccttttaggaggagtc 114  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33162309 cagagactagaagggaaggggataggctgtgggaaatttggtggtgccgccggacggcaacggcggcgagggagaggctcgcagccttttaggaggagtc 33162210  T
115 tttgagagagaatctcgtcgtctggacatgatccattaacgtcgtaggacatgaaactgcggatatcgtcgggaaatagggtacatgcactgccggcggg 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
33162209 tttgagagagaatctcgtcgtctggacatgatccattaacgtcgtaggacatgaagctgcggatatcgtcgggaaatagggtacatgcactgccggcggg 33162110  T
215 agggtggacg 224  Q
    ||||||||||    
33162109 agggtggacg 33162100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University