View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2912_high_21 (Length: 227)
Name: NF2912_high_21
Description: NF2912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2912_high_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 52563232 - 52563003
Alignment:
| Q |
1 |
cacgagagaaccaaacagacacgtaaaaaagtattctaggctttcagctgacaatatttacatagcaaaatgaataacaccccaaaatattaatctgnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52563232 |
cacgagagaaccaaacagacacgtaagaaagtattctaggctttcagctgacaatatttacatatcaaaatgaataacaccccaaaatattaatctgaaa |
52563133 |
T |
 |
| Q |
101 |
nnnn---caattattgtgttccattgacggagnnnnnnntgaattgtattatttatctgaaaaatagtgatttgtttgaaaggagcgagtggtaaatttg |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52563132 |
aaaaaaacaattattgtgttccattgacggagaaaaaattgaattgtattatttatctgaaaaatagtgatttgtttgaaaggagcgagtggtaaatttg |
52563033 |
T |
 |
| Q |
198 |
gattcccttctccggtgaattggttgatga |
227 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
52563032 |
gattcccttcaccggtgaattggttgatga |
52563003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University