View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2912_low_12 (Length: 284)
Name: NF2912_low_12
Description: NF2912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2912_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 14134408 - 14134683
Alignment:
| Q |
1 |
caaagggtcccccactacccacacctgtgatggcatacattggagtgggtatcaaatatattttgtttcttgtgtgggactcaatttttaatagtagcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14134408 |
caaagggtcccccactacccacacctgtgatggcatacattggagtgggtatcaaatatattttgtttcttgtgtgggactcaatttttaatagtagcat |
14134507 |
T |
 |
| Q |
101 |
atcatatatgcacatcttaatggataagatggtagtatctttttagtgagaatttgagaaaaagacaacattgatcaattcaataaagatggatggataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14134508 |
atcatatatgcacatcttaatggataagatggtagcatctttttagtgagaatttgagaaaaagacaacattgatcaattcaataaagatggatggataa |
14134607 |
T |
 |
| Q |
201 |
caactttagctgattgcatctagggtcgatgaccatacgtgacactagggttgaaggatatccaaggtttcatctc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14134608 |
caactttagctgattgcatctagggtcgatgaccatacgtgacactagggttgaaggatatccaaggtttgatctc |
14134683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University