View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2912_low_15 (Length: 250)
Name: NF2912_low_15
Description: NF2912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2912_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 89 - 234
Target Start/End: Complemental strand, 9141252 - 9141108
Alignment:
| Q |
89 |
tggaactatttgattttggtttttgaatctcaaacttcgatattatcgtttcacatttactttgcaggttacatgttcannnnnnnnacattgatttggt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
9141252 |
tggaactatttgattttggtttttgaatctcaaacttcgatattatcgtttcacatttactttgcaggttatatattca-tttttttacattgatttggt |
9141154 |
T |
 |
| Q |
189 |
gaaatttgattcaagagctatgcaaaaggatactagtcctacttct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9141153 |
gaaatttgattcaagagctatgcaaaaggatactagtcctacttct |
9141108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University