View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2912_low_20 (Length: 243)
Name: NF2912_low_20
Description: NF2912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2912_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 33162309 - 33162100
Alignment:
| Q |
15 |
cagagactagaagggaaggggataggcagtgggaaatttggtggtgccgccggacggcaacggcggcgagggagaggctcgcagccttttaggaggagtc |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33162309 |
cagagactagaagggaaggggataggctgtgggaaatttggtggtgccgccggacggcaacggcggcgagggagaggctcgcagccttttaggaggagtc |
33162210 |
T |
 |
| Q |
115 |
tttgagagagaatctcgtcgtctggacatgatccattaacgtcgtaggacatgaaactgcggatatcgtcgggaaatagggtacatgcactgccggcggg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33162209 |
tttgagagagaatctcgtcgtctggacatgatccattaacgtcgtaggacatgaagctgcggatatcgtcgggaaatagggtacatgcactgccggcggg |
33162110 |
T |
 |
| Q |
215 |
agggtggacg |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
33162109 |
agggtggacg |
33162100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University