View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2912_low_24 (Length: 207)
Name: NF2912_low_24
Description: NF2912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2912_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 5 - 129
Target Start/End: Original strand, 31532808 - 31532932
Alignment:
| Q |
5 |
atgggagagcaaaaattggaggatgagtatagtcattgccgtctaagnnnnnnnnctcacattattaatcgtctcatgagacaacaattaaatagctaaa |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31532808 |
atgggagagcaaaaattagaggatgagtatagtcattgccgtctaagttttttttctcacattatcaatcgtctcatgagacaacaattaaatagctaaa |
31532907 |
T |
|
| Q |
105 |
caattgaatacataactcttttgtc |
129 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31532908 |
caattgaatacataactcttttgtc |
31532932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 31532953 - 31533008
Alignment:
| Q |
139 |
taagtacataaatctctcttattaggtttaacaaagtaattcatctcatcacaggttc |
196 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31532953 |
taagtacataaatctc--ttattaggtttaacaaagtaattcatctcatcaccggttc |
31533008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University