View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2913_low_1 (Length: 442)
Name: NF2913_low_1
Description: NF2913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2913_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 334 - 418
Target Start/End: Original strand, 49693038 - 49693122
Alignment:
| Q |
334 |
ttcgagaaatttacatgtcataccactcatccaaactgtatgcgcacaaaaattcctttcgatgtcttattttctatcatttgat |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49693038 |
ttcgagaaatttacatgtcataccactcatccaaactgtatgcgcacaaaaattcctttcgatgtcttattttctatcatttgat |
49693122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University