View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_high_22 (Length: 241)
Name: NF2916_high_22
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 27066390 - 27066615
Alignment:
| Q |
1 |
agcgcttgatcctttttctgaatatccagagaaatcagatttgaagacgttagcatttttcgcatactgagtgaaaccgttaactgcgtgaatagagtct |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066390 |
agcgcttgagcctttttctgaatatccagagaaatcagatttgaagacgttagcatttttcgcatactgagtgaaaccgttaactgcgtgaatagagtct |
27066489 |
T |
|
| Q |
101 |
ttgccgtaacttgcgaaactttggttaccggagttaccaccatcgctgtagcttacgaatgattgttctcttccggtcacggaggctgtgtaggtggtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066490 |
ttgccgtaacttgcgaaactttggttaccggagttaccaccatcgctgtagcttacgaatgattgttctcttccggtcacggaggctgtgtaggtggtga |
27066589 |
T |
|
| Q |
201 |
attttacgttaggaatgttgctttct |
226 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
27066590 |
attttaggttaggaatgttgctttct |
27066615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University