View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_low_12 (Length: 380)
Name: NF2916_low_12
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 20 - 369
Target Start/End: Complemental strand, 21598078 - 21597729
Alignment:
| Q |
20 |
cgatcaacagactctcatgaacttctcgtccttcccaaagctagtgaaaatacaatgactcgttgtctcacttggtgggacttaacatggctcgctttcg |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21598078 |
cgatcaacagactcccatgaacttctcgtccttcccaaagccagtgaaaatacaatgactcgttgtctcacttggtgggacttaacatggctcgctttcg |
21597979 |
T |
 |
| Q |
120 |
gcgctgttgttggctctggtatcttcgtcgttacaggtcaagaagctcgtctcgatgctggtccttccattatcctctcttacgccgcgtcaggtttctc |
219 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21597978 |
gcgctgtcgttggctctggtatcttcgtcgttaccggtcaagaagctcgtttcgatgctggtccttccattatcctctcttacgccgcgtcaggtttctc |
21597879 |
T |
 |
| Q |
220 |
tgctcttctttcagctttaatctacgctgaattcgccgttgaagttcctgttgctggtggctcattttcattcctaagaattgaacttggtgattttctc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21597878 |
tgctcttctttcagctttaatctacgctgaattcgccgttgaagttcctgttgctggtggctcgttttcattccttagaattgaacttggtgattttctc |
21597779 |
T |
 |
| Q |
320 |
gctttcattgccgctgggaatattctccttgaagctctcgtctgtgctgc |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21597778 |
gctttcattgccgctgggaatattctccttgaagctctcgtcggtgctgc |
21597729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 112; Significance: 2e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 175 - 370
Target Start/End: Complemental strand, 11987687 - 11987492
Alignment:
| Q |
175 |
tgctggtccttccattatcctctcttacgccgcgtcaggtttctctgctcttctttcagctttaatctacgctgaattcgccgttgaagttcctgttgct |
274 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||| ||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
11987687 |
tgctggtccttccattatcctctcctacgccgcttcaggattctcagctcttctttcagctttcatctatgctgaattcgcagttgaagttcccgttgcc |
11987588 |
T |
 |
| Q |
275 |
ggtggctcattttcattcctaagaattgaacttggtgattttctcgctttcattgccgctgggaatattctccttgaagctctcgtctgtgctgct |
370 |
Q |
| |
|
||||| || |||| |||||||||||| ||||| ||||| || |||||||||||||| || ||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
11987587 |
ggtggttcgttttgattcctaagaatcgaactcggtgacttcctcgctttcattgctgccgggaatattctccttgaagctattgtcggtgctgct |
11987492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University