View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_low_17 (Length: 279)
Name: NF2916_low_17
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_low_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 19 - 279
Target Start/End: Complemental strand, 11312947 - 11312687
Alignment:
| Q |
19 |
agaaggcacgaagtttgaagaacatgttgatgacaatcaaaaaggggtcacgaacccttgaagaatatctacgcgaattcaaatcaatttgtgacaatct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312947 |
agaaggcacgaagtttgaagaacatgttgatgacaatcaaaaaggggtcacgaacccttgaagaatatctacgcgaattcaaatcaatttgtgacaatct |
11312848 |
T |
 |
| Q |
119 |
tgctgctataaaagaaacggtttcagaccaagacaaagtgtttcaatttgcttatggacttggaccaagctatgaaacttttcgtgttgctatgcttact |
218 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312847 |
tgctgctataaaagaaccggtttctgaccaagacaaagtgtttcaatttgcttatggacttggaccaagctatgaaacttttcgtgttgctatgcttact |
11312748 |
T |
 |
| Q |
219 |
aaaccgccttacccttcattcagtcagtttctattagctcctcaaggacatgagcagatac |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11312747 |
aaaccgccttacccttcattcagtcagtttctattagctcttcaaggacatgagcagatac |
11312687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University