View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_low_21 (Length: 264)
Name: NF2916_low_21
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_low_21 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 12 - 264
Target Start/End: Original strand, 11312384 - 11312636
Alignment:
| Q |
12 |
aagaataatcatacctgtaccagcaatcaacagcttcatgattcaattttatgcaaatttgacaagcacttttactctcgttgatttgacgtggcttttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11312384 |
aagaataatcatacctgtaccagcaatcaacagcttcatgattcggttttctgcaaatttgacaagcacttttactctcgttgttttgacgtggcttttc |
11312483 |
T |
 |
| Q |
112 |
tccctttgaactgtggttatgcttgacgaagacctcgttgttttgaggtccattatatcgacctactggagtaaaacctcttccttgagagttaaagtga |
211 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312484 |
tccctttgaactgtggttatgcttgacagagaactcgttgttttgaggtccattatatcgacctgctggagtaaaacctcttccttgagagttaaagtga |
11312583 |
T |
 |
| Q |
212 |
cctctaccgccaagtccgcttcgacctcgacctcttcctctttgactaaagaa |
264 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312584 |
cctctaccgccacgtccgcttcgacctcgacctcttcctctttgactaaagaa |
11312636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University