View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_low_25 (Length: 245)
Name: NF2916_low_25
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_low_25 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0326 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 24)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 112 - 240
Target Start/End: Original strand, 3832199 - 3832327
Alignment:
| Q |
112 |
tattatgtttattataagaacgagaatggattagacgaggtttcaaattacggaacaggatgcttaaaatctaggctaaaatatgattttagtccttata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| ||| || |
|
|
| T |
3832199 |
tattatgtttattataagaacgagaatggattagacgaggtttcaaattacgaaacaggatgcataaaatctaggctaaaatatgattttagttcttgta |
3832298 |
T |
 |
| Q |
212 |
aatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
3832299 |
aatatgtttggttttggttttagcctctg |
3832327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 3832119 - 3832201
Alignment:
| Q |
1 |
tacaatgcctgcccgtatatatcatgatgatattatttcagtactagttgtgacttgtcaggtgcaaaacgttgaaatactat |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3832119 |
tacaatgcctgcccgtatatatcatgatgatattatttcagtactagttgtgacttgtcaggtgcaaaacgttgaaatactat |
3832201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 2265398 - 2265346
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
2265398 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc |
2265346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 29182167 - 29182223
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||| |||||||||||||||||| |
|
|
| T |
29182167 |
aggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctg |
29182223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 45442697 - 45442645
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
45442697 |
aggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtc |
45442645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 17912447 - 17912504
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
17912447 |
taggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctg |
17912504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 29865513 - 29865460
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
29865513 |
taggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc |
29865460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 38639410 - 38639467
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
38639410 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg |
38639467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 25954114 - 25954166
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtc |
25954166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 41693673 - 41693725
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
41693673 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
41693725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 43672319 - 43672267
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||||| ||||||||||||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtc |
43672267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 10671943 - 10671890
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
10671943 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
10671890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 11788418 - 11788365
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
11788418 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
11788365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 23989836 - 23989889
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
23989836 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 43592044 - 43592097
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
43592044 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
43592097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 3172533 - 3172481
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| | ||||||||||||||| |
|
|
| T |
3172533 |
aggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtc |
3172481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 19183781 - 19183833
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
19183781 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19183833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 236
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
188 |
taaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||| ||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 241
Target Start/End: Complemental strand, 26239164 - 26239104
Alignment:
| Q |
181 |
tctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||| | |||||| |||||||| |||| |
|
|
| T |
26239164 |
tctaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgc |
26239104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 31644840 - 31644896
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctg |
31644896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 37228732 - 37228788
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctg |
37228788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 43597500 - 43597448
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
43597500 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc |
43597448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 43710709 - 43710657
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| | ||||||||||||||| |
|
|
| T |
43710709 |
aggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtc |
43710657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 236
Target Start/End: Complemental strand, 44985993 - 44985933
Alignment:
| Q |
176 |
taaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||| | |||||||| | ||||||||||||||| |
|
|
| T |
44985993 |
taaaatttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtc |
44985933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 22)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 236
Target Start/End: Original strand, 42207238 - 42207293
Alignment:
| Q |
181 |
tctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
42207238 |
tctaggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtc |
42207293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 22551318 - 22551264
Alignment:
| Q |
186 |
gctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||| ||||||||||||||||||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctg |
22551264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 10744056 - 10744003
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
10744056 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
10744003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 14318043 - 14318096
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
14318043 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
14318096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 9179592 - 9179644
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtc |
9179644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 23381948 - 23382000
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
23381948 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
23382000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 29693091 - 29693039
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
29693091 |
aggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
29693039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 38496783 - 38496731
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
38496783 |
aggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
38496731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 174 - 241
Target Start/End: Original strand, 19565456 - 19565523
Alignment:
| Q |
174 |
cttaaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||| | |||||||| | ||||||||||||||| |||| |
|
|
| T |
19565456 |
cttaaaatcaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgc |
19565523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 236
Target Start/End: Original strand, 21050575 - 21050626
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| || |||||| |||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtc |
21050626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 240
Target Start/End: Original strand, 42553642 - 42553697
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||||||| |||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctg |
42553697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 178 - 240
Target Start/End: Complemental strand, 31037748 - 31037686
Alignment:
| Q |
178 |
aaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||| |||||||||||||| ||||||||| | |||||||| | |||||||||||| |||||| |
|
|
| T |
31037748 |
aaatttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctg |
31037686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 241
Target Start/End: Original strand, 35876678 - 35876744
Alignment:
| Q |
175 |
ttaaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||| | ||||||| || ||||||||||||||| |||| |
|
|
| T |
35876678 |
ttaaaatcaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgc |
35876744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 235
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||||| ||||||||| | ||||||||| | |||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 240
Target Start/End: Complemental strand, 16038738 - 16038685
Alignment:
| Q |
187 |
ctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||||||||| | ||||||| | ||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctg |
16038685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 20690731 - 20690788
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||| |||| |||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
20690731 |
taggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctg |
20690788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 36577720 - 36577773
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
36577720 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
36577773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 39379612 - 39379559
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
39379612 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
39379559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 40029140 - 40029189
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggtttta |
233 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||| | |||||||||||| |
|
|
| T |
40029140 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 4736543 - 4736491
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||||| ||||||||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
4736491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 26133414 - 26133362
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
26133414 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
26133362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 38786158 - 38786210
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
38786158 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
38786210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 19)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 30709646 - 30709588
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| | |||||||||||||||||||| |
|
|
| T |
30709646 |
taggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctgc |
30709588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 6911081 - 6911133
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||||| |||||||| |
|
|
| T |
6911081 |
aggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtc |
6911133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 185 - 240
Target Start/End: Original strand, 21223405 - 21223460
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| || ||||||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctg |
21223460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 31310363 - 31310420
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| | | ||||||||||||||||||| |
|
|
| T |
31310363 |
taggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctg |
31310420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 44958507 - 44958455
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| | ||||||||||||||| |
|
|
| T |
44958507 |
aggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtc |
44958455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 236
Target Start/End: Original strand, 1974009 - 1974060
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
1974060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 239
Target Start/End: Complemental strand, 37953048 - 37952997
Alignment:
| Q |
188 |
taaaatatgattttagtccttataaatatgtttggttttggttttagtctct |
239 |
Q |
| |
|
||||||||| ||||||||| | ||||||||| | |||||||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtctct |
37952997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 236
Target Start/End: Complemental strand, 44403249 - 44403198
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
44403198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 18022706 - 18022653
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
18022706 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
18022653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 23816668 - 23816725
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| | ||||||||||||||||||| |
|
|
| T |
23816668 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctg |
23816725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 240
Target Start/End: Original strand, 35469870 - 35469935
Alignment:
| Q |
175 |
ttaaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||| |||||||||||| |||| ||| | |||||||||| ||||||||||||||||||| |
|
|
| T |
35469870 |
ttaaaatcatggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctg |
35469935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 39832904 - 39832957
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
39832904 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39832957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 5234205 - 5234153
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| |||| |||| || |||||||| | ||||||||||||||| |
|
|
| T |
5234205 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
5234153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 6509471 - 6509419
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||| | ||||||||||||||| |
|
|
| T |
6509471 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
6509419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 236
Target Start/End: Original strand, 30709328 - 30709376
Alignment:
| Q |
188 |
taaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||| || ||||||| | ||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtc |
30709376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggtttta |
233 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| || |||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 38486476 - 38486528
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
||||||||||||||||||| |||| | ||||||||| | ||||| |||||||| |
|
|
| T |
38486476 |
taggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 44344790 - 44344738
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
44344790 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
44344738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 48854071 - 48854019
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||| ||||||||||||||| |
|
|
| T |
48854071 |
aggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtc |
48854019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 29)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 22584285 - 22584342
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| | ||||||||||||||||||| |
|
|
| T |
22584285 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctg |
22584342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 182 - 239
Target Start/End: Original strand, 28448831 - 28448888
Alignment:
| Q |
182 |
ctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctct |
239 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
28448831 |
ctaggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtctct |
28448888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 13764808 - 13764756
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| |||| |||| | ||||||||||| ||||||||||||||| |
|
|
| T |
13764808 |
aggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtc |
13764756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 22099913 - 22099857
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
22099913 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg |
22099857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 25358540 - 25358484
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||| | ||||||||||||||| |||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctgc |
25358484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 52442093 - 52442041
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
52442093 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
52442041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 232
Target Start/End: Complemental strand, 9446323 - 9446276
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggtttt |
232 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| | ||||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 236
Target Start/End: Original strand, 28809011 - 28809062
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtc |
28809062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 236
Target Start/End: Original strand, 35415291 - 35415350
Alignment:
| Q |
177 |
aaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||| |||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
35415291 |
aaaatataggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc |
35415350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 236
Target Start/End: Complemental strand, 13479614 - 13479560
Alignment:
| Q |
182 |
ctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
13479614 |
ctaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
13479560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 9289264 - 9289317
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
9289264 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
9289317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 236
Target Start/End: Complemental strand, 18831176 - 18831127
Alignment:
| Q |
187 |
ctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||| | ||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
18831127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 20291984 - 20292041
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||||||||| |||| | ||||||| | ||||||||||||||||||| |
|
|
| T |
20291984 |
taggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctg |
20292041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 30564835 - 30564884
Alignment:
| Q |
187 |
ctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtc |
30564884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 43368467 - 43368516
Alignment:
| Q |
187 |
ctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
43368516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 46088062 - 46088009
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
46088062 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
46088009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 51708691 - 51708748
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| | ||||||||||||||||||| |
|
|
| T |
51708691 |
taggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctg |
51708748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 53716919 - 53716972
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
53716919 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
53716972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 6827545 - 6827597
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
6827545 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 6827875 - 6827823
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
6827875 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
6827823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 8760782 - 8760730
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
8760782 |
aggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtc |
8760730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 24474964 - 24474912
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
24474964 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
24474912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 29380911 - 29380859
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
29380911 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
29380859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 34361802 - 34361854
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
34361802 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
34361854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 41620257 - 41620205
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
41620257 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtc |
41620205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 41921085 - 41921033
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| |||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
41921085 |
aggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtc |
41921033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 42823774 - 42823826
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||| | |||||||||||||| |
|
|
| T |
42823774 |
taggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42823826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 45474597 - 45474541
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| || | ||||||||||||||||| |
|
|
| T |
45474597 |
aggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctg |
45474541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 55072388 - 55072440
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
55072388 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
55072440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 21)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 186 - 236
Target Start/End: Original strand, 30969399 - 30969449
Alignment:
| Q |
186 |
gctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtc |
30969449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 18549199 - 18549256
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| || ||||||||||||||||||| |
|
|
| T |
18549199 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctg |
18549256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 241
Target Start/End: Complemental strand, 24187898 - 24187841
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| | ||||||||||||||| |||| |
|
|
| T |
24187898 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctgc |
24187841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 28399037 - 28398984
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
28399037 |
taggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtc |
28398984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 32040073 - 32040126
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||| ||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
32040073 |
taggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtc |
32040126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 7272419 - 7272475
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
7272419 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg |
7272475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 9175011 - 9175063
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| | ||||||||||||||| |
|
|
| T |
9175011 |
aggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtc |
9175063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 181 - 236
Target Start/End: Complemental strand, 8094845 - 8094790
Alignment:
| Q |
181 |
tctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
8094845 |
tctaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
8094790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 236
Target Start/End: Original strand, 29487750 - 29487801
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||| ||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtc |
29487801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 235
Target Start/End: Original strand, 38930301 - 38930352
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||||| | |||||||||||||| |
|
|
| T |
38930301 |
aggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38930352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 241
Target Start/End: Complemental strand, 3512276 - 3512210
Alignment:
| Q |
175 |
ttaaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
||||||| |||||||||||||| |||| |||| | |||||||| | ||||||||||||||| |||| |
|
|
| T |
3512276 |
ttaaaatttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgc |
3512210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 241
Target Start/End: Original strand, 2728231 - 2728288
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| | ||||||||||||||| |||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgc |
2728288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 241
Target Start/End: Complemental strand, 4017301 - 4017244
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |||| |
|
|
| T |
4017301 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgc |
4017244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 29158352 - 29158405
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
29158352 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
29158405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 33526414 - 33526361
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
33526414 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
33526361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 33636320 - 33636373
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
33636320 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
33636373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 1525808 - 1525864
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| | ||||||||||||||||||| |
|
|
| T |
1525808 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctg |
1525864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 14238750 - 14238802
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
14238750 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
14238802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 19494117 - 19494169
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | |||||||||||||| |
|
|
| T |
19494117 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19494169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 20984511 - 20984459
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| |||| |||| || |||||||| | ||||||||||||||| |
|
|
| T |
20984511 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
20984459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 28324182 - 28324130
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| |||| |||| || |||||||| | ||||||||||||||| |
|
|
| T |
28324182 |
aggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtc |
28324130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 28)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 185 - 235
Target Start/End: Complemental strand, 275833 - 275783
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| || |||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Complemental strand, 20757777 - 20757720
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
20757777 |
taggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtctctg |
20757720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 45313498 - 45313555
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| || |||||| ||||||| |||| |
|
|
| T |
45313498 |
taggctaaaatatgattttggtccttgtaaatatgattcgttttgattttagtatctg |
45313555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 46622131 - 46622078
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||| ||||||||||||||| |
|
|
| T |
46622131 |
taggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtc |
46622078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 20611019 - 20611075
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| || ||||||||||||||||||| |
|
|
| T |
20611019 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctg |
20611075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 39288572 - 39288628
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
39288572 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctg |
39288628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 46186772 - 46186716
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
46186772 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctg |
46186716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 237
Target Start/End: Original strand, 16679678 - 16679728
Alignment:
| Q |
187 |
ctaaaatatgattttagtccttataaatatgtttggttttggttttagtct |
237 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| || |||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtct |
16679728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 28452378 - 28452320
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||||||||| |||| |||| || ||||||| || ||||||||||||||| |||| |
|
|
| T |
28452378 |
taggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctgc |
28452320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 29490746 - 29490688
Alignment:
| Q |
182 |
ctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||||| |||| |||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
29490746 |
ctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctg |
29490688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 236
Target Start/End: Complemental strand, 45320990 - 45320928
Alignment:
| Q |
174 |
cttaaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
45320990 |
cttaaaattaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
45320928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 863279 - 863336
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||| | ||||| ||||||||||||| |
|
|
| T |
863279 |
taggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctg |
863336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 236
Target Start/End: Complemental strand, 3152121 - 3152060
Alignment:
| Q |
175 |
ttaaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
3152121 |
ttaaaatttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
3152060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 15979703 - 15979650
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| |||| |||| || |||||||| | ||||||||||||||| |
|
|
| T |
15979703 |
taggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
15979650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 28452145 - 28452198
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||| | ||||||||||||||| |
|
|
| T |
28452145 |
taggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtc |
28452198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 29446208 - 29446155
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
29446208 |
taggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
29446155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 34238596 - 34238649
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
34238596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
34238649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 51834944 - 51834891
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
51834944 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
51834891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 5345690 - 5345638
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
5345690 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
5345638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 22008525 - 22008577
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
22008525 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22008577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 22016043 - 22016095
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
22016043 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22016095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 26799887 - 26799939
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
26799887 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
26799939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 30130156 - 30130208
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | |||||||||||||| |
|
|
| T |
30130156 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
30130208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 30268504 - 30268556
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
30268504 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
30268556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 35177254 - 35177310
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| | |||||||||||||| |||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctg |
35177310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 39436717 - 39436769
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
39436717 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39436769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 43440494 - 43440546
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| | ||||| ||||||||| |
|
|
| T |
43440494 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
43440546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 47114486 - 47114538
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| | ||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 29)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Complemental strand, 4617397 - 4617340
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||||||||| || | | |||||||||| ||||||||||||||||||| |
|
|
| T |
4617397 |
taggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtctctg |
4617340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 183 - 240
Target Start/End: Complemental strand, 26324949 - 26324892
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | ||||||||||||||||||| |
|
|
| T |
26324949 |
taggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctg |
26324892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 15211510 - 15211566
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| |||| |||| | ||||||||| | ||||||||||||||||||| |
|
|
| T |
15211510 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctg |
15211566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 188 - 236
Target Start/End: Original strand, 20756022 - 20756070
Alignment:
| Q |
188 |
taaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| | ||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtc |
20756070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 185 - 236
Target Start/End: Complemental strand, 34383244 - 34383193
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||| | ||||||||||||||| |
|
|
| T |
34383244 |
ggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtc |
34383193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 10887231 - 10887289
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||||||||| |||| |||| | |||||||||| ||||||||||||||| |||| |
|
|
| T |
10887231 |
taggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgc |
10887289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Complemental strand, 13260323 - 13260265
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |||| |
|
|
| T |
13260323 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgc |
13260265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 37625026 - 37624972
Alignment:
| Q |
186 |
gctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||| | ||||||||| ||||||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctg |
37624972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 237
Target Start/End: Original strand, 48955712 - 48955766
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtct |
237 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | |||||||||||||||| |
|
|
| T |
48955712 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtct |
48955766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 7867127 - 7867180
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| | ||||| ||||||||| |
|
|
| T |
7867127 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtc |
7867180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 241
Target Start/End: Complemental strand, 15526371 - 15526306
Alignment:
| Q |
176 |
taaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
||||||| ||||||||||||| |||| |||| | |||||||| | ||||||||||||||| |||| |
|
|
| T |
15526371 |
taaaatcaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgc |
15526306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 19622653 - 19622706
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
19622653 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19622706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 21383102 - 21383155
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
21383102 |
taggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtc |
21383155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 21391094 - 21391147
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
21391094 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
21391147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 232
Target Start/End: Original strand, 33067346 - 33067395
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggtttt |
232 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| | ||||||||||| |
|
|
| T |
33067346 |
taggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 48609596 - 48609543
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
48609596 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 50429211 - 50429158
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
50429211 |
taggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
50429158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 990087 - 990139
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||| | ||||||||||||||| |
|
|
| T |
990087 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
990139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 3679625 - 3679677
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||| | ||||||||||||||| |
|
|
| T |
3679625 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtc |
3679677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 3753573 - 3753521
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
3753573 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
3753521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 6567497 - 6567445
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
6567497 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
6567445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 14007488 - 14007540
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
14007540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 185 - 237
Target Start/End: Complemental strand, 17984701 - 17984649
Alignment:
| Q |
185 |
ggctaaaatatgattttagtccttataaatatgtttggttttggttttagtct |
237 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| | |||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtct |
17984649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 31258338 - 31258390
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
31258338 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtc |
31258390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 34002941 - 34002889
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
34002941 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
34002889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 41358665 - 41358613
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | |||||||||||||| |
|
|
| T |
41358665 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
41358613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 41881092 - 41881144
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
41881092 |
aggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtc |
41881144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 45290456 - 45290508
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
45290456 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
45290508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 46868225 - 46868281
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||| || |||||||||||||||||| |
|
|
| T |
46868225 |
aggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctg |
46868281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 235
Target Start/End: Complemental strand, 10517 - 10465
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
10517 |
taggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
10465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 15)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 11448536 - 11448588
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
11448536 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
11448588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 235
Target Start/End: Original strand, 25431575 - 25431626
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||||| |||||| ||||||| |
|
|
| T |
25431575 |
aggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagt |
25431626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 543726 - 543676
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggtttta |
233 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| || |||||||||||| |
|
|
| T |
543726 |
taggctaaaatatgattttagtccctgcaaatatgctttgttttggtttta |
543676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 15962025 - 15962083
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |||| |
|
|
| T |
15962025 |
taggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgc |
15962083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 318099 - 318046
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||| ||| | |||||||||| ||||||||||||||| |
|
|
| T |
318099 |
taggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtc |
318046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 241
Target Start/End: Complemental strand, 3414753 - 3414696
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctgc |
241 |
Q |
| |
|
||||||||||||| |||| |||| | ||||||||| | ||||||||||||||| |||| |
|
|
| T |
3414753 |
aggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgc |
3414696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 187 - 236
Target Start/End: Complemental strand, 14428948 - 14428899
Alignment:
| Q |
187 |
ctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtc |
14428899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 14655377 - 14655430
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
14655377 |
taggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
14655430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 25431856 - 25431803
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
25431856 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
25431803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 6468309 - 6468361
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| || ||||||||||||||| |
|
|
| T |
6468309 |
aggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtc |
6468361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 9896638 - 9896586
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
9896638 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
9896586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 236
Target Start/End: Original strand, 10091039 - 10091087
Alignment:
| Q |
188 |
taaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||| ||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtc |
10091087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 14656261 - 14656209
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| |||| |||||| |||||||| | ||||||||||||||| |
|
|
| T |
14656261 |
aggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtc |
14656209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 30928680 - 30928732
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
30928680 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
30928732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 31398542 - 31398490
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| | |||||||||||||| |
|
|
| T |
31398542 |
aggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtc |
31398490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 4039 - 4092
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
4039 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
4092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 183 - 236
Target Start/End: Original strand, 19221 - 19274
Alignment:
| Q |
183 |
taggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
19221 |
taggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
19274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 175 - 236
Target Start/End: Complemental strand, 27374 - 27313
Alignment:
| Q |
175 |
ttaaaatctaggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||| |||||||||||||| |||| |||| | |||||||| | ||||||||||||||| |
|
|
| T |
27374 |
ttaaaatttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
27313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 1310 - 1362
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
1310 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
1362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 8546 - 8598
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| | ||||||||||||||| |
|
|
| T |
8546 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
8598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 290 - 238
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
290 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 235
Target Start/End: Original strand, 17126 - 17174
Alignment:
| Q |
187 |
ctaaaatatgattttagtccttataaatatgtttggttttggttttagt |
235 |
Q |
| |
|
|||||||||| |||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 54814 - 54866
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
54814 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
54866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 5398 - 5454
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtctctg |
240 |
Q |
| |
|
||||||||||||| ||||||||| | ||||||| | ||||||||||||||||||| |
|
|
| T |
5398 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctg |
5454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 184 - 236
Target Start/End: Complemental strand, 5709 - 5657
Alignment:
| Q |
184 |
aggctaaaatatgattttagtccttataaatatgtttggttttggttttagtc |
236 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||| | ||||||||||||||| |
|
|
| T |
5709 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtc |
5657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University