View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_low_28 (Length: 211)
Name: NF2916_low_28
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 12333211 - 12333012
Alignment:
| Q |
1 |
gtttccatttacacgctccacatcttttgtcttccccttcaacttcatagcgatttccattcatcaccatccctgaagt--cgccatcatcaccaccgt- |
97 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
12333211 |
gtttccatttacacgctccacatctttcgtcttccccttcaacttcatcatgatttccattcatcaccatccctgaagtgtcgccatcgtcaccaccgta |
12333112 |
T |
 |
| Q |
98 |
-ccgccgtccttccttccttattccccgttctagggttcctttcttcttctcaggtttgtttcttgttcctcttttattttttataaataacatctgttc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12333111 |
gccgccgtccttccttccttattccccgttctagggttcctttcttcttctcaggtttgtttcttgttcctcttttattttttataaataacatctgttc |
12333012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University