View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_low_5 (Length: 443)
Name: NF2916_low_5
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 376; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 376; E-Value: 0
Query Start/End: Original strand, 20 - 431
Target Start/End: Original strand, 37418663 - 37419074
Alignment:
| Q |
20 |
cttgaccctcggagcgattggattgagcacttgaaggcctgctggaatgtgaacttgtaggcctgctcgtctttttcgcctcaatctcagaatccagctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37418663 |
cttgaccctcggagcgattggattgagcacttgaaggcctgctggaatgtgaacttgtaggcctactcgtctttttcgcctcaatctcagaatccagctt |
37418762 |
T |
 |
| Q |
120 |
cttccaatcatatcctttctccgccaacacttcctccctaggcctcgccgcaccaaatggattaggcttattcgtcttcaccaccggagattcattgaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37418763 |
cttccaatcatatcctttctccgccaacacttcctccctaggcctcgccgcaccaaatggattaggcttattcgtcttcaccaccggagattcattgaca |
37418862 |
T |
 |
| Q |
220 |
gaactatcacctttccttggatccaaaaccaacctcggacgctgctgttgctccgaatcacgccgcggtgctcccctagcccaacgatctggttccacag |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
37418863 |
gaactatcacctttccttggatccaaaaccaacctcggacgctgctgttgctccgaatcacgccgcggcgctcctctagcccaacgatctggttccacag |
37418962 |
T |
 |
| Q |
320 |
cagaacctctagaccagcgatctggtcccattcaaaaatcaggaaaaccgccataagatctaacaggaagaggtttcttaccaaccgcccaattatccac |
419 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37418963 |
cagaacctctagaccagcgatctggttccattccagaatcacgagaaccgccataagatctaacaggaagaggtttcttaccaaccgcccaattatccac |
37419062 |
T |
 |
| Q |
420 |
tccatctgcctt |
431 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
37419063 |
tccatccgcctt |
37419074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University