View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2916_low_9 (Length: 412)
Name: NF2916_low_9
Description: NF2916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2916_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 10692137 - 10692371
Alignment:
| Q |
11 |
cagagagttcaacccaaaaccaaaagaagaaagatgggagtgacaccgaaaatagctccttcgatgctatcatcagattttgctaatttggcttccgaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10692137 |
cagagagttcaacccaaaaccaaaagaagaaagatgggagtgacaccgaaaatagctccttcgatgctatcatcagattttgctaatttggcttccgaag |
10692236 |
T |
 |
| Q |
111 |
ctcatcgtatgatcaattctggcgctgattggcttcacatggatatcatggtacttatttacgcccttctcttctcgaattcaatttatttcaattctat |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10692237 |
ctcatcgtatgatcaattacggcgctgattggcttcacatggatatcatggtacttacttactcccttctcttctcgaattcaatttatttcaattctat |
10692336 |
T |
 |
| Q |
211 |
gaaccacccactttaattggaattactggtatcta |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10692337 |
gaaccacccactttaattggaattactggtatcta |
10692371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 326 - 394
Target Start/End: Original strand, 10692454 - 10692520
Alignment:
| Q |
326 |
tgtcactatttgtttttgtttaacgacgaagcaaggacattgacatgtagacaccgataataattaaag |
394 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
10692454 |
tgtcactatttgtttttgttgaacgacgaagcaaggaca--cacatgtagacactgataataattaaag |
10692520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 361 - 394
Target Start/End: Original strand, 4382835 - 4382868
Alignment:
| Q |
361 |
gacattgacatgtagacaccgataataattaaag |
394 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
4382835 |
gacaatgacatgtagacaccgataataattaaag |
4382868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University