View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2917_high_17 (Length: 250)
Name: NF2917_high_17
Description: NF2917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2917_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 25 - 233
Target Start/End: Original strand, 5175741 - 5175949
Alignment:
| Q |
25 |
gtttcactctctccatcagagaagaagaacaaaaacaggacagcaaatgtggcggttacctagtggtagctctttgtccttgtctcgtatgtttcattct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5175741 |
gtttcactctctccatcagagaagaagaacaaaaacaggacagcaaatgtggcggttacctagtggtagctctttgtccttgtctcgtatgtttcattct |
5175840 |
T |
|
| Q |
125 |
tctcttaattgttctttcgatcattcttattgtcaaattccacnnnnnnngtcacacccctcttcattccttgttctacnnnnnnnnctgctgaatcccc |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
5175841 |
tctcttaattgttctttcgatcgttcttattgtcaaattccactttttttgtcacacccctcttcattccttgttctacaaaaaaaactgctaaatcccc |
5175940 |
T |
|
| Q |
225 |
atttgggtg |
233 |
Q |
| |
|
||||||||| |
|
|
| T |
5175941 |
atttgggtg |
5175949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 61 - 203
Target Start/End: Original strand, 1016467 - 1016609
Alignment:
| Q |
61 |
aggacagcaaatgtggcggttacctagtggtagctctttgtccttgtctcgtatgtttcattcttctcttaattgttctttcgatcattcttattgtcaa |
160 |
Q |
| |
|
||||||||||||| ||||| | ||| ||||||||||||||| ||||||| |||||||||||||||| ||||| ||||||| ||| || |||||||||| |
|
|
| T |
1016467 |
aggacagcaaatgcggcgggtgccttatggtagctctttgtcattgtctcatatgtttcattcttcttctaattattctttcaatcgttattattgtcaa |
1016566 |
T |
|
| Q |
161 |
attccacnnnnnnngtcacacccctcttcattccttgttctac |
203 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1016567 |
attccactttttttgtcacacccctcttcattccttgttctac |
1016609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University