View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2917_high_5 (Length: 358)
Name: NF2917_high_5
Description: NF2917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2917_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 5e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 131 - 289
Target Start/End: Original strand, 3081018 - 3081176
Alignment:
| Q |
131 |
aaagaatgtcttgtaaaagtttttaaaaatgagaagaaaaactatcccattttgttatgagaccactgaataaataaggtgaaaagttaaggctaatttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3081018 |
aaagaatgtcttgtaaaagtttttaaaaatgagaagaaaaactatctcattttgttatgagaccactgaataaataaggtgaaaagttacggctaatttt |
3081117 |
T |
 |
| Q |
231 |
taatctcaattattacatgtttttggttatcagaagaaaaactagagtgtttcctacaa |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
3081118 |
taatctcaattattacatgtttttggttatcagtagaaaaactagtgtgtttcctacaa |
3081176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University