View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2917_low_16 (Length: 303)
Name: NF2917_low_16
Description: NF2917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2917_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 85 - 287
Target Start/End: Complemental strand, 55161747 - 55161544
Alignment:
| Q |
85 |
ggaaggaaggagcgtaaacgtaccagaaaaagaatagatagtgtcgtaagtaagattatagaggacaagtgaagaaggcatgttgatgttggtgttgtta |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55161747 |
ggaaggaaggagcgtaaacgtaccagaaaaagaatagatagtgtcgtaagtaagattatagaggacaagtgaagaaggcatgttgatgttggtgttgtta |
55161648 |
T |
 |
| Q |
185 |
acagcattacccttgtccttgatattgaaaactcctcctccgtaaagtggcttctctggatgctctttgcactgtc-aaagtctcaactatgcatgtcag |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55161647 |
acagcattacccttgtccttgatattgaaaactcctcctccgtaaagtggcttctctggatgctctttgcactgtcaaaagtctcaactatgcatgtcag |
55161548 |
T |
 |
| Q |
284 |
ttct |
287 |
Q |
| |
|
|||| |
|
|
| T |
55161547 |
ttct |
55161544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University