View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2917_low_20 (Length: 267)
Name: NF2917_low_20
Description: NF2917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2917_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 23 - 267
Target Start/End: Complemental strand, 48600263 - 48600019
Alignment:
| Q |
23 |
tgatcatgattatgcaacaaggttttaaataaggattttgtgatttcagctgttatagatgccgctttgcatggaatattagtcgtcttggtgtgaatta |
122 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48600263 |
tgatcatgattgtgtaacaaggttttaaataaggattttgtgatttcagctgttatagatgcagctttgcatggaatattagtcgtcttggtgtgaatta |
48600164 |
T |
 |
| Q |
123 |
atcacggtgttagctatctattgaacttatccaatagaagataagatagcatttcataagttatatcatagttaggtgataatactattgcatatgataa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48600163 |
atcacggtgttagctatctattgaacttatccaatagaagataagatagcatttcataagttatagcatagttaggtgataatactattgcatatgataa |
48600064 |
T |
 |
| Q |
223 |
tccttttcttctcccttgttcatgcattcatactgcaatgccatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48600063 |
tccttttcttctcccttgttcatgcattcatactgcaatgccatt |
48600019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University