View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2917_low_21 (Length: 252)
Name: NF2917_low_21
Description: NF2917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2917_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 45178686 - 45178913
Alignment:
| Q |
18 |
attctagatagtagcaaatgtnnnnnnngaaacacagatcttatttgatacaacctatgaagcactaatacttgcattatctttacctattgtattgaat |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45178686 |
attctagatagtagcaaatgtaaaaaatgaaacacagatcttatttgatagaacctattaagcactaatacttgcattatctttacctattgtattgaat |
45178785 |
T |
|
| Q |
118 |
acttgtctgatactgatactaatttgttaagtacctgcatcaatttcttttttctatctaaagtccatttcaacatacaaatctgatcaatgcctgaggc |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45178786 |
acttgtttgatactgatactaatttgttaagtacctgcatcaatttcttttttctatctaaagtccatttcaacatacaaatctgatcaatgcctgaggc |
45178885 |
T |
|
| Q |
218 |
gatttgtacgcatgatatttttcatctc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
45178886 |
gatttgtacgcatgatatttttcatctc |
45178913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 114
Target Start/End: Original strand, 45168922 - 45168980
Alignment:
| Q |
56 |
tcttatttgatacaacctatgaagcactaatacttgcattatctttacctattgtattg |
114 |
Q |
| |
|
||||||| || | ||||||||||||||||||| ||||||| |||| ||||||| ||||| |
|
|
| T |
45168922 |
tcttattggacagaacctatgaagcactaatatttgcattgtcttcacctattctattg |
45168980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 69 - 114
Target Start/End: Complemental strand, 24123768 - 24123723
Alignment:
| Q |
69 |
aacctatgaagcactaatacttgcattatctttacctattgtattg |
114 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| ||||||||||||| |
|
|
| T |
24123768 |
aacctatgaagcactaatatttgcattgtcttcacctattgtattg |
24123723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University