View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2917_low_26 (Length: 247)
Name: NF2917_low_26
Description: NF2917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2917_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 4749853 - 4750082
Alignment:
| Q |
1 |
tgttgatccaaatttctcttatatttaagaccgaagaagtattattattttaacaaagtatttttgcctgaattaaaaataaccatctttcaactaagtt |
100 |
Q |
| |
|
||||||| |||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4749853 |
tgttgattcaaatttctcgtatatttaagatcgaagaagtactattattttaacaaagtatttttgcctgaattaaaaataaccatctttcaactaagtt |
4749952 |
T |
|
| Q |
101 |
gcatggttatttccaaaatgaaaattatgattttaacatgatatattctacactatagattattgggttatttccaaaataaaacgtatgttttgatatg |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
4749953 |
gcatggttatttctaaaatgaaaattatgattttaacatgatatattctacactatagattattggcttatttccaaaataaaaagtatgttttgatatg |
4750052 |
T |
|
| Q |
201 |
atatattctacattataggttattgatgag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4750053 |
atatattctacattataggttattgatgag |
4750082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 201 - 230
Target Start/End: Original strand, 4758373 - 4758402
Alignment:
| Q |
201 |
atatattctacattataggttattgatgag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4758373 |
atatattctacattataggttattgatgag |
4758402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University